Παρασκευή, 10 Ιανουαρίου 2014

Γενετικός Κώδικας (θα τον χρησιμοποιήσετε για να λύσετε τις ασκήσεις της μετάφρασης DNA)


Άσκηση αvτιγραφής, μεταγραφής και μετάφρασης DNA








Άσκηση αντιγραφής, μεταγραφής και μετάφρασης DNA
Σας δίνεται το παρακάτω μονόκλωνο τμήμα DNA:



ACCTACGATGTTCGACGCGGTCAGCTACCCGAGATAACCTTG





1. Ποια είναι η συμπληρωματική του αλυσίδα; 



2. Το δίκλωνο DNA αντιγράφεται. Ποια θα είναι τα μόρια DNA που θα παραχθούν; 

3. Μέσα στο δίκλωνο αυτό DNA υπάρχει ένα γονίδιο.
Οριοθετείστε με κάθετες γραμμές την αρχή
και το τέλος του γονιδίου.





4. Ποιό θα είναι το mRNA που θα προκύψει μετά την μεταγραφή;


5 Ποια θα είναι η πρωτεϊνη που θα παραχθεί από την μετάφραση του mRNA;

6. Ποιό είναι το κεντρικό δόγμα της Βιολογίας σχηματικά;


Πέμπτη, 5 Δεκεμβρίου 2013

Τετάρτη, 4 Δεκεμβρίου 2013

Βιολογία - Άσκηση κατασκευής πρωτεϊνης

Στον σύνδεσμο που ακολουθεί μπορείτε να βρείτε το φύλλο εργασίας για την κατασκευή πρωτείνης από 25 τουλάχιστον αμινοξέα, στη σελίδα 10 του τετραδίου εργασιών της βιολογίας.

Ασκήσεις και φύλλα εργασίας βιολογίας γ΄γυμνασίου


Τρίτη, 3 Δεκεμβρίου 2013

Χημεία - Ασκήσεις ονοματολογίας ανοργάνων ενώσεων



Ονοματολογία ανόργανων ενώσεων
Φάση 1η 

Α-1 Να ονομαστούν οι παρακάτω ενώσεις:
Χημική Ένωση
Ονομασία
H2S

Ca(OH)2

Η2CO3

H2SO3

Fe(OΗ)3

H3PO4

ΚΝΟ3

ΗΝΟ2

Pb(ΟΗ)4

ΑgOΗ

ΗΙ

CaS

Pb(OH)2

HCN

 Aℓ(OH)3

CO2

Al(OH)3

FeO

Cu2O

Pb(CO3)2


Α-2 Να ονομαστούν οι παρακάτω ενώσεις:

Χημική Ένωση
Ονομασία
Κ2S

CaSO3

Aℓ2(CO3 )3

PbBr2

CuNO3

Ag3PO4

Cl2O7

Zn(ΝΟ2)2

KMnO4

ΑgCℓ

ZnO

KNO2

PbSO4

Fe(CN)2

(NH4)3PO3

CuBr2

N2O5


Φάση 2η 

Α-3 Να γράψετε τους χημικούς τύπους στις παρακάτω ενώσεις:

Χημική Ένωση
Ονομασία
Κατηγορία Χημικής ένωσης

Υδροφθόριο


υδροξείδιο του Fe(III)


θειώδες οξύ


υδροξείδιο του βαρίου


υδροξείδιο του Cu (I)


διοξείδιο του αζώτου


υδροκυάνιο


υδροξείδιο του χρωμίου (VI) 


υδροξείδιο του ασβεστίου


υδροξείδιο του Zn


νιτρικό οξύ


οξείδιο του σιδήρου (ΙΙΙ) 


Υδρόθειο


θειικό οξύ


Φωσφορικό οξύ


υδροξείδιο του μολύβδου (ΙΙ)


Α-4 Να γράψετε τους χημικούς τύπους στις παρακάτω ενώσεις:

Χημική Ένωση
Ονομασία
Κατηγορία Χημικής ένωσης

χλωριούχος άργυρος


νιτρικό ασβέστιο


ανθρακικός σίδηρος (ΙΙ) 


φθοριούχο αμμώνιο


θειούχος χαλκό (Ι)


Υποχλωριώδες αργίλιο


κυανιούχος Zn


νιτρικό χρώμιο (VI) 


ιωδιούχος μόλυβδος (ΙV)


φωσφορικό κάλιο


νιτρώδες αργίλιο


θειούχος σίδηρος (ΙΙΙ) 


θειώδες ασβέστιο


θειικός κασσίτερος (ΙV)


Φωσφορικό βάριο


αμμωνία


θειικό αργίλιο


τετροξείδιο του αζώτου


Οξείδιο του Cr (III)


τριοξείδιο του αζώτου


Θειούχος Pb(IV)